DNA Binding Site

Accessions: 1cjg_C (3D-footprint 20260701), 1cjg_D (3D-footprint 20260701)
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 22
Sequence: GAATTGTGAGCGCTCACAATTC
Binding TFs: 1cjg_B (Bacterial regulatory proteins, lacI family)
Binding Motifs: 1cjg_AB TgAGCGCTCA
1cjg_B TGAGC
Publications: Spronk C.A, Bonvin A.M, Radha P.K, Melacini G, Boelens R, Kaptein R. The solution structure of Lac repressor headpiece 62 complexed to a symmetrical lac operator. Structure (London, England : 1993) 7:1483-92 (1999). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.