DNA Binding Site

Accessions: 2r1j_A (3D-footprint 20241219)
Organisms: Enterobacteria phage P22
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: TATTTAAGATATCTTAAATG
Binding TFs: 2r1j_L / 2r1j_R (Helix-turn-helix, Helix-turn-helix domain, Cro/C1-type HTH DNA-binding domain, Helix-turn-helix domain)
Binding Motifs: 2r1j_L TTAAG
2r1j_LR TTAAGnnnnCTTAA
Publications: Watkins D, Hsiao C, Woods K.K, Koudelka G.B, Williams L.D. P22 c2 repressor-operator complex: mechanisms of direct and indirect readout. Biochemistry 47:2325-38 (2008). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.