DNA Binding Site
Accessions: | 3swm_F (3D-footprint 20231221) |
Organisms: | Arabidopsis thaliana |
Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 24 |
Sequence: | CTGTTGCGTGTCCAACACGCAAGA |
Binding TFs: | 3swm_B / 3swm_D (No apical meristem (NAM) protein) |
Binding Motifs: | 3swm_ABD TGCnTGnnnnnnaCGCAA 3swm_B CAnGCA |
Publications: | Welner D.H, Lindemose S, Grossmann J.G, Møllegaard N.E, Olsen A.N, Helgstrand C, Skriver K, Lo Leggio L. DNA binding by the plant-specific NAC transcription factors in crystal and solution: a firm link to WRKY and GCM transcription factors. The Biochemical journal 444:395-404 (2012). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.