DNA Binding Site

Accessions: 1bdt_F (3D-footprint 20231221), 1bdv_F (3D-footprint 20231221), 1par_F (3D-footprint 20231221)
Organisms: Enterobacteria phage P22
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 21
Sequence: ATGATAGAAGCACTCTACTAT
Type: Heterodimer
Binding TFs: 1par_B / 1par_D (Arc-like DNA binding domain)
1bdt_C / 1bdt_D (Arc-like DNA binding domain)
1bdv_B (Arc-like DNA binding domain)
1bdv_D (Arc-like DNA binding domain)
Binding Motifs: 1bdt_ABCD TTaTAGAannnnTCTACcA
1bdt_C tnatAGA
1bdv_ABCD TnTAGAAnnncTCTA
1bdv_B CTnTAnnA
1par_ABCD TGTTAGAannnnTCTAyyA
1par_B TAnta
Publications: Schildbach J.F, Karzai A.W, Raumann B.E, Sauer R.T. Origins of DNA-binding specificity: role of protein contacts with the DNA backbone. Proceedings of the National Academy of Sciences of the United States of America 96:811-7 (1999). [Pubmed]

Raumann B.E, Rould M.A, Pabo C.O, Sauer R.T. DNA recognition by beta-sheets in the Arc repressor-operator crystal structure. Nature 367:754-7 (1994). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.