DNA Binding Site
| Accessions: | 6xwg_A (3D-footprint 20250804) |
| Organisms: | Homo sapiens |
| Libraries: | 3D-footprint 20250804 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 21 |
| Sequence: | AGGGTTCACCGAAAGTTCACT |
| Binding TFs: | 6xwg_D (Zinc finger, C4 type (two domains)) |
| Binding Motifs: | 6xwg_CD GTTCAnnnnnaGTTcA 6xwg_D TgaAC |
| Publications: | Osz J, McEwen AG, Bourguet M, Przybilla F, Peluso-Iltis C, Poussin-Courmontagne P, Mély Y, Cianférani S, Jeffries CM, Svergun DI, Rochel N. Structural basis for DNA recognition and allosteric control of the retinoic acid receptors RAR-RXR. Nucleic Acids Res 48:9969-9985 (2020). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.