DNA Binding Site
| Accessions: | 1zg1_C (3D-footprint 20260701), 1zg1_H (3D-footprint 20260701) |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | CGTACTCCTTAATGGGTACG |
| Binding TFs: | 1zg1_B / 1zg1_E / 1zg1_F (Bacterial regulatory proteins, luxR family, Sigma-70, region 4, Sigma-70, region 4, Winged helix-turn-helix DNA-binding) |
| Binding Motifs: | 1zg1_E TACT 1zg1_AB TACTnnTnnaTnGGTA 1zg1_EF TACCcATnnangAGTA |
| Publications: | Maris AE., Kaczor-Grzeskowiak M., Ma Z., Kopka ML., Gunsalus RP., Dickerson RE. Primary and secondary modes of DNA recognition by the NarL two-component response regulator. Biochemistry. 44(44):14538-52 (2005). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.