DNA Binding Site

Accessions: 6omf_T (3D-footprint 20241219)
Organisms: Salmonella enterica subsp. enterica serovar Typhimurium
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 43
Sequence: TCCCAGTAATTAACGAGAGCACCGGCTATGTGTTCCGCTATTC
Binding TFs: 6omf_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4)
Binding Motifs: 6omf_F TAACgnGAGCAnCnnnnnnnnnnnncGcT
Publications: Cartagena AJ, Banta AB, Sathyan N, Ross W, Gourse RL, Campbell EA, Darst SA. Structural basis for transcription activation by Crl through tethering of σ(S) and RNA polymerase. Proc Natl Acad Sci U S A 116:18923-18927 (2019). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.