DNA Binding Site
| Accessions: | 3d6y_B (3D-footprint 20231221), 3d6z_B (3D-footprint 20231221) |
| Organisms: | Bacillus subtilis, strain 168 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 24 |
| Sequence: | TGACCCTCCCCTTAGGGGAGGGTC |
| Binding TFs: | 3d6y_A / 3d6z_A (MerR family regulatory protein, GyrI-like small molecule binding domain, MerR HTH family regulatory protein) |
| Binding Motifs: | 3d6y_A CCCT 3d6z_A CCCT |
| Publications: | Newberry K.J, Huffman J.L, Miller M.C, Vazquez-Laslop N, Neyfakh A.A, Brennan R.G. Structures of BmrR-drug complexes reveal a rigid multidrug binding pocket and transcription activation through tyrosine expulsion. The Journal of biological chemistry 283:26795-804 (2008). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.