DNA Binding Site

Accessions: 4mtd_Y (3D-footprint 20260701), 4mte_Y (3D-footprint 20260701)
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 31
Sequence: AGAAGTGTGATATTATAACATTTCATGACTA
Type: Heterodimer
Binding TFs: 4mtd_B (Ferric uptake regulator family)
4mtd_D / 4mte_D (Ferric uptake regulator family)
Binding Motifs: 4mtd_ABCD TGAaATGTTATAAyATnACA
4mtd_B TATAATA
4mte_ABCD TGAnATGnTATAATATCACA
4mte_D TATcACA
Publications: Gilston B.A, Wang S, Marcus M.D, Canalizo-Hernández M.A, Swindell E.P, Xue Y, Mondragón A, O'Halloran T.V. Structural and mechanistic basis of zinc regulation across the E. coli Zur regulon. PLoS biology 12:e1001987 (2014). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.