DNA Binding Site
| Accessions: | 1au7_D (3D-footprint 20250804) |
| Organisms: | Rattus norvegicus |
| Libraries: | 3D-footprint 20250804 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 24 |
| Sequence: | CTTCCTCATGTATATACATGAGGA |
| Type: | Heterodimer |
| Binding TFs: | 1au7_A (Homeobox domain, Pou domain - N-terminal to homeobox domain) 1au7_B (Homeobox domain, Pou domain - N-terminal to homeobox domain) |
| Binding Motifs: | 1au7_A TGTATATaCAT 1au7_AB tcATGTATATACAT |
| Publications: | Jacobson E.M, Li P, Leon-del-Rio A, Rosenfeld M.G, Aggarwal A.K. Structure of Pit-1 POU domain bound to DNA as a dimer: unexpected arrangement and flexibility. Genes & development 11:198-212 (1997). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.