DNA Binding Site

						

			
Accessions: 6ama_R (3D-footprint 20231221)

			
Organisms: strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745, Streptomyces venezuelae
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 99
Sequence: ATTCGGGTAATTCGGGTAATTCGGGTAATTCGGGTAATTCGGGTAATTCGGGTAATTCGG
GTAATTCGGGTAATTCGGGTAATTCGGGTAATTCGGGTA
Type: Heterodimer
Binding TFs: 6ama_L (MerR family regulatory protein, Helix-turn-helix domain, MerR HTH family regulatory protein)
6ama_Y (MerR family regulatory protein, Helix-turn-helix domain, MerR HTH family regulatory protein)
Binding Motifs: 6ama_ABCDGHKLOPY TACCCGnnnTACCCnAnnTACCCnAnnTACCCnnnTTACCCGnnTTACCCGnnnTACCCGnnnTACCCGnnTTACCCGnnnTACCCnnnTTACCCG
6ama_L annCGGGTA
			
Publications: Schumacher MA, den Hengst CD, Bush MJ, Le TBK, Tran NT, Chandra G, Zeng W, Travis B, Brennan RG, Buttner MJ. The MerR-like protein BldC binds DNA direct repeats as cooperative multimers to regulate Streptomyces development. Nat Commun 9:1139 (2018). [Pubmed]

	
			


			

				

				
				
				
				

			

			

		

	
Disclaimer and license


These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.