DNA Binding Site
| Accessions: | 2hdd_D (3D-footprint 20231221), 2hos_D (3D-footprint 20231221), 2hot_D (3D-footprint 20231221) |
| Organisms: | Drosophila melanogaster |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | TCCGGGGATTACATGGCAAA |
| Type: | Heterodimer |
| Binding TFs: | 2hdd_A (Homeobox domain) 2hdd_B (Homeobox domain) 2hos_A (Homeobox domain) 2hos_B / 2hot_B (Homeobox domain) |
| Binding Motifs: | 2hdd_A tGGATTAC 2hdd_AB TCcnnGGaTTAC 2hos_A TaATCc 2hos_AB TCCnnGGATTA 2hot_AB TAATCcnngG |
| Publications: | Tucker-Kellogg L, Rould M.A, Chambers K.A, Ades S.E, Sauer R.T, Pabo C.O. Engrailed (Gln50-->Lys) homeodomain-DNA complex at 1.9 A resolution: structural basis for enhanced affinity and altered specificity. Structure (London, England : 1993) 5:1047-54 (1997). [Pubmed] Simon M.D, Feldman M.E, Rauh D, Maris A.E, Wemmer D.E, Shokat K.M. Structure and properties of a re-engineered homeodomain protein-DNA interface. ACS chemical biology 1:755-60 (2006). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.