DNA Binding Site

						

			
Accessions: ggaA (DBTBS 1.0)

			
Names: ggaA
Organisms: Bacillus subtilis
Libraries: DBTBS 1.0 1
1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed]
Length: 85
Sequence: tgatgatttacatttttaaagagccTTAACTtttataggaacatatgcTATTATtgttta
ttattaatggaacgtaaaaaatatg
Binding TFs: SigA (Sigma-70 factor, region 1.2, Sigma-70 factor, region 1.1, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4)
Binding Motifs: SigA_1 TTGACw
SigA_2 TAtAAT
			
Publications: Freymond P.P, Lazarevic V, Soldo B, Karamata D. Poly(glucosyl-N-acetylgalactosamine 1-phosphate), a wall teichoic acid of Bacillus subtilis 168: its biosynthetic pathway and mode of attachment to peptidoglycan. Microbiology (Reading, England) 152:1709-18 (2006). [Pubmed]

	
			


			

				

				
				
				
				

			

			

		

	
Disclaimer and license


These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.