DNA Binding Site

Accessions: 4ldx_D (3D-footprint 20231221)
Organisms: Arabidopsis thaliana
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 21
Sequence: TTGTCTCCCAAAGGGAGACAA
Type: Heterodimer
Binding TFs: 4ldx_A (B3 DNA binding domain, Auxin response factor)
4ldx_B (B3 DNA binding domain, Auxin response factor)
Binding Motifs: 4ldx_A GGGAnACAA
4ldx_AB TTGTntCCCnnnGGGAnACA
Publications: Boer D.R, Freire-Rios A, van den Berg W.A, Saaki T, Manfield I.W, Kepinski S, López-Vidrieo I, Franco-Zorrilla J.M, de Vries S.C, Solano R, Weijers D, Coll M. Structural basis for DNA binding specificity by the auxin-dependent ARF transcription factors. Cell 156:577-89 (2014). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.