DNA Binding Site

Accessions: 1d3u_D (3D-footprint 20250804)
Organisms: Pyrococcus woesei
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 23
Sequence: TATAAGTATTTAAACTTTACTCT
Binding TFs: 1d3u_A (Transcription factor TFIID (or TATA-binding protein, TBP))
Binding Motifs: 1d3u_A TTTAAATA
1d3u_AB TATTTAAAnnTTACT
Publications: Littlefield O, Korkhin Y, Sigler P.B. The structural basis for the oriented assembly of a TBP/TFB/promoter complex. Proceedings of the National Academy of Sciences of the United States of America 96:13668-73 (1999). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.