DNA Binding Site
| Accessions: | MA1660.1.13 (JASPAR 2024), MA1674.1.8 (JASPAR 2024), UN0349.1.11 (JASPAR 2024) |
| Organisms: | Arabidopsis thaliana |
| Libraries: | JASPAR 2024 1 1 Rauluseviciute I, Riudavets-Puig R, Blanc-Mathieu R, Castro-Mondragon JA, Ferenc K, Kumar V, Lemma RB, Lucas J, Cheneby J, Baranasic D, Khan A, Fornes O, Gundersen S, Johansen M, Hovig E, Lenhard B, Sandelin A, Wasserman WW, Parcy F, Mathelier A. JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles. Nucleic Acids Res : (2023). [Pubmed] |
| Length: | 24 |
| Sequence: | GCGTTGCTTGTCAAACAAGCAATA |
| Type: | Heterodimer |
| Binding TFs: | F4IED2 (No apical meristem (NAM) protein) Q9XIC5 (No apical meristem (NAM) protein) Q9LS24 (No apical meristem (NAM) protein) F4IED2 Q9LS24 Q9XIC5 |
| Binding Motifs: | MA1660.1 wdtTTaCTTGttctcCAAGtAAhh MA1674.1 wdgTTwCTTGttsmaCAAGwAAhh UN0349.1 wrgTTaCTTGtrwyaCAAGtAAyc |
| Publications: | De Clercq I, Vermeirssen V, Van Aken O, Vandepoele K, Murcha MW, Law SR, Inzé A, Ng S, Ivanova A, Rombaut D, van de Cotte B, Jaspers P, Van de Peer Y, Kangasjärvi J, Whelan J, Van Breusegem F. The membrane-bound NAC transcription factor ANAC013 functions in mitochondrial retrograde regulation of the oxidative stress response in Arabidopsis. Plant Cell 25:3472-90 (2013). [Pubmed] Ng S, Ivanova A, Duncan O, Law SR, Van Aken O, De Clercq I, Wang Y, Carrie C, Xu L, Kmiec B, Walker H, Van Breusegem F, Whelan J, Giraud E. A membrane-bound NAC transcription factor, ANAC017, mediates mitochondrial retrograde signaling in Arabidopsis. Plant Cell 25:3450-71 (2013). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.