DNA Binding Site
| Accessions: | 4iwr_G (3D-footprint 20231221) |
| Organisms: | Enterobacter sp. RFL1396 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 24 |
| Sequence: | ATGTGACTTATAGTCCGTGTGATT |
| Binding TFs: | 4iwr_F (Helix-turn-helix, Helix-turn-helix domain) |
| Binding Motifs: | 4iwr_EF CGGAmnnnnnGTCACA 4iwr_F gTCcG |
| Publications: | Martin RN, McGeehan JE, Ball NJ, Streeter SD, Thresh SJ, Kneale GG. Structural analysis of DNA-protein complexes regulating the restriction-modification system Esp1396I. Acta Crystallogr Sect F Struct Biol Cryst Commun : (2013). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.