DNA Binding Site

Accessions: 5c8e_I (3D-footprint 20260701), 5c8e_K (3D-footprint 20260701)
Organisms: strain HB27 / ATCC BAA-163 / DSM 7039, Thermus thermophilus
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 26
Sequence: ATAGGTTTTGTCAAGCTTTTGTACAT
Type: Heterodimer
Binding TFs: 5c8e_C (MerR family regulatory protein, B12 binding domain, MerR HTH family regulatory protein)
5c8e_G (MerR family regulatory protein, B12 binding domain, MerR HTH family regulatory protein)
Binding Motifs: 5c8e_EG annnwnTgt
5c8e_BC TACAnnnnnnTGACA
5c8e_C TgTCa
Publications: Jost M, Fernández-Zapata J, Polanco MC, Ortiz-Guerrero JM, Chen PY, Kang G, Padmanabhan S, Elías-Arnanz M, Drennan CL. Structural basis for gene regulation by a B12-dependent photoreceptor. Nature 526:536-41 (2015). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.