DNA Binding Site
| Accessions: | hmp_1 (DBTBS 1.0) |
| Names: | hmp_1 |
| Organisms: | Bacillus subtilis |
| Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
| Length: | 40 |
| Sequence: | attgataattttgtgacaactttattaaagattcatttta |
| Binding TFs: | ResD (Response regulator receiver domain, Transcriptional regulatory protein, C terminal) |
| Binding Motifs: | ResD AATyTTGTGAm |
| Publications: | Nakano M.M, Zhu Y. Involvement of ResE phosphatase activity in down-regulation of ResD-controlled genes in Bacillus subtilis during aerobic growth. Journal of bacteriology 183:1938-44 (2001). [Pubmed] LaCelle M, Kumano M, Kurita K, Yamane K, Zuber P, Nakano M.M. Oxygen-controlled regulation of the flavohemoglobin gene in Bacillus subtilis. Journal of bacteriology 178:3803-8 (1996). [Pubmed] Nakano M.M, Zhu Y, Lacelle M, Zhang X, Hulett F.M. Interaction of ResD with regulatory regions of anaerobically induced genes in Bacillus subtilis. Molecular microbiology 37:1198-207 (2000). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.