DNA Binding Site
Accessions: | 1jt0_E (3D-footprint 20231221), 1jt0_F (3D-footprint 20231221) |
Organisms: | Staphylococcus aureus |
Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 28 |
Sequence: | CTTATAGACCGATCGATCGGTCTATAAG |
Type: | Heterodimer |
Binding TFs: | 1jt0_C (Bacterial regulatory proteins, tetR family, QacR-like protein, C-terminal region) 1jt0_D (Bacterial regulatory proteins, tetR family, QacR-like protein, C-terminal region) |
Binding Motifs: | 1jt0_ABCD ATngACCnATCGAnnGGTcTAT 1jt0_C ATAGACC |
Publications: | Schumacher M.A, Miller M.C, Grkovic S, Brown M.H, Skurray R.A, Brennan R.G. Structural basis for cooperative DNA binding by two dimers of the multidrug-binding protein QacR. The EMBO journal 21:1210-8 (2002). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.