DNA Binding Site
| Accessions: | 3nbn_X (3D-footprint 20231221) |
| Organisms: | Homo sapiens |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 35 |
| Sequence: | ACTGTGGGAAAGAAGTTTGGAAAATTTCACACGAG |
| Binding TFs: | 3nbn_D (IPT/TIG domain, Beta-trefoil DNA-binding domain, LAG1, DNA binding) |
| Binding Motifs: | 3nbn_AD CTgTGGGAAnnnnnnnnnnnnnnnTTCnCA 3nbn_D TTCnCAnG |
| Publications: | Arnett K.L, Hass M, McArthur D.G, Ilagan M.X, Aster J.C, Kopan R, Blacklow S.C. Structural and mechanistic insights into cooperative assembly of dimeric Notch transcription complexes. Nature structural & molecular biology 17:1312-7 (2010). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.