DNA Binding Site

Accessions: 1hjb_H (3D-footprint 20250804), 1hjb_J (3D-footprint 20250804), 1io4_F (3D-footprint 20250804)
Organisms: Homo sapiens, Mus musculus
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 25
Sequence: CGCAACCACAGAGTTTGGAAATCTT
Type: Heterodimer
Binding TFs: 1hjb_A (bZIP transcription factor, Basic region leucine zipper)
1hjb_C / 1hjb_F / 1io4_C (Runt domain)
1io4_B (bZIP transcription factor, Basic region leucine zipper)
Binding Motifs: 1io4_B tcnaAa
1hjb_A gGaAA
1hjb_ABC TTTCCAAAnnnTGTGGTTG
1hjb_DEF AACCACAnnnTTTGGAAA
1io4_ABC TTTCCAAAnnnTGTGGT
Publications: Tahirov T.H, Inoue-Bungo T, Morii H, Fujikawa A, Sasaki M, Kimura K, Shiina M, Sato K, Kumasaka T, Yamamoto M, Ishii S, Ogata K. Structural analyses of DNA recognition by the AML1/Runx-1 Runt domain and its allosteric control by CBFbeta. Cell 104:755-67 (2001). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.