DNA Binding Site

Accessions: 6jbx_C (3D-footprint 20231221)
Organisms: strain ATCC BAA-255 / R6, Streptococcus pneumoniae
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 23
Sequence: AATAGTTTGACTGTCAAATTATG
Type: Heterodimer
Binding TFs: 6jbx_A (MarR family, MarR family, Winged helix DNA-binding domain)
6jbx_B (MarR family, MarR family, Winged helix DNA-binding domain)
Binding Motifs: 6jbx_A TCnaATnAT
6jbx_AB ATnnTnYgnnnnTcnnAnnAT
Publications: Zuo G, Chen ZP, Jiang YL, Zhu Z, Ding C, Zhang Z, Chen Y, Zhou CZ, Li Q. Structural insights into repression of the Pneumococcal fatty acid synthesis pathway by repressor FabT and co-repressor acyl-ACP. FEBS Lett 593:2730-2741 (2019). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.