DNA Binding Site
| Accessions: | 1qp9_E (3D-footprint 20231221), 2hap_A (3D-footprint 20231221) |
| Organisms: | Saccharomyces cerevisiae |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | ACGCTATTATCGCTATTAGT |
| Type: | Heterodimer |
| Binding TFs: | 1qp9_B (Fungal Zn(2)-Cys(6) binuclear cluster domain) 2hap_D (Fungal Zn(2)-Cys(6) binuclear cluster domain) |
| Binding Motifs: | 1qp9_AB CGCnnnTATCGCnnnTAG 1qp9_B ATAnnnGCG 2hap_CD CGCtntTATCGC 2hap_D ATAAnaGCG |
| Publications: | Lukens A.K, King D.A, Marmorstein R. Structure of HAP1-PC7 bound to DNA: implications for DNA recognition and allosteric effects of DNA-binding on transcriptional activation. Nucleic acids research 28:3853-63 (2000). [Pubmed] King D.A, Zhang L, Guarente L, Marmorstein R. Structure of HAP1-18-DNA implicates direct allosteric effect of protein-DNA interactions on transcriptional activation. Nature structural biology 6:22-7 (1999). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.