DNA Binding Motif

Accessions: 5e3n_B (3D-footprint 20250804)
Names: DNA-binding protein Fis
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Description: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
Length: 6
Consensus: ccnACA
Weblogo:
PSSM: P0 A C G T
01 13 54 13 16 c
02 13 54 13 16 c
03 24 24 24 24 n
04 96 0 0 0 A
05 0 96 0 0 C
06 96 0 0 0 A
Binding TFs: 5e3n_B (Bacterial regulatory protein, Fis family)
Binding Sites: 5e3n_C
5e3n_D
Publications: Hancock SP, Stella S, Cascio D, Johnson RC. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. PLoS One : (2016). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.