DNA Binding Motif
Accessions: | 4ihv_B (3D-footprint 20241219) |
Names: | DNA-binding protein fis |
Libraries: | 3D-footprint 20241219 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Description: | Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) |
Length: | 6 |
Consensus: | canaCA |
Weblogo: | ![]() |
PSSM: | P0 A C G T 01 13 57 13 13 c 02 34 20 22 20 a 03 24 24 24 24 n 04 54 14 14 14 a 05 8 70 8 10 C 06 74 7 8 7 A |
Binding TFs: | 4ihv_B (Bacterial regulatory protein, Fis family) |
Binding Sites: | 4ihv_C 4ihv_D |
Publications: | Hancock S.P, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson R.C. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic acids research 41:6750-60 (2013). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.