DNA Binding Motif
| Accessions: | MA1352.1 (JASPAR 2024), M0614 (AthalianaCistrome v4_May2016) |
| Names: | TRP1, T25146;, TRP1.DAP |
| Organisms: | Arabidopsis thaliana |
| Libraries: | JASPAR 2024 1, AthalianaCistrome v4_May2016 2 1 Rauluseviciute I, Riudavets-Puig R, Blanc-Mathieu R, Castro-Mondragon JA, Ferenc K, Kumar V, Lemma RB, Lucas J, Cheneby J, Baranasic D, Khan A, Fornes O, Gundersen S, Johansen M, Hovig E, Lenhard B, Sandelin A, Wasserman WW, Parcy F, Mathelier A. JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles. Nucleic Acids Res : (2023). [Pubmed] 2 O'Malley RC, Huang SS, Song L, Lewsey MG, Bartlett A, Nery JR, Galli M, Gallavotti A, Ecker JR. Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape. Cell 165:1280-92 (2016). [Pubmed] |
| Notes: | DAP-seq |
| Length: | 23 |
| Consensus: | AAACCCTAAACCCTAAACCCTAA |
| Weblogo: | ![]() |
| PSSM: | P0 A C G T 01 45 0 0 3 A 02 44 0 0 4 A 03 47 0 0 1 A 04 0 44 1 3 C 05 5 39 2 2 C 06 2 36 5 5 C 07 0 0 0 48 T 08 47 0 0 1 A 09 47 0 1 0 A 10 48 0 0 0 A 11 0 43 0 5 C 12 4 43 0 1 C 13 0 47 1 0 C 14 1 0 0 47 T 15 47 0 0 1 A 16 43 2 0 3 A 17 46 0 2 0 A 18 0 43 1 4 C 19 8 39 0 1 C 20 3 45 0 0 C 21 2 1 0 45 T 22 47 0 0 1 A 23 44 0 0 4 A |
| Type: | Heterodimer |
| Binding TFs: | Q8L7L8 / T25146 Q8L7L8 |
| Binding Sites: | MA1352.1.1 MA1352.1.10 / MA1352.1.19 / MA1352.1.4 MA1352.1.11 MA1352.1.12 / MA1352.1.15 / MA1352.1.5 / MA1352.1.8 / MA1352.1.9 MA1352.1.13 MA1352.1.14 / MA1352.1.17 / MA1352.1.7 MA1352.1.16 / MA1352.1.18 MA1352.1.2 / MA1352.1.3 MA1352.1.20 MA1352.1.6 |
| Publications: | Zhong R, Ye ZH. MYB46 and MYB83 bind to the SMRE sites and directly activate a suite of transcription factors and secondary wall biosynthetic genes. Plant Cell Physiol 53:368-80 (2012). [Pubmed] Chen CM, Wang CT, Ho CH. A plant gene encoding a Myb-like protein that binds telomeric GGTTTAG repeats in vitro. J Biol Chem 276:16511-9 (2001). [Pubmed] O'Malley RC, Huang SS, Song L, Lewsey MG, Bartlett A, Nery JR, Galli M, Gallavotti A, Ecker JR. Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape. Cell 165:1280-92 (2016). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.
