DNA Binding Motif
| Accessions: | 5e3l_B (3D-footprint 20250804) |
| Names: | DNA-binding protein Fis |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20250804 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Description: | Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT) |
| Length: | 6 |
| Consensus: | CAnACC |
| Weblogo: | ![]() |
| PSSM: | P0 A C G T 01 9 67 11 9 C 02 69 9 9 9 A 03 24 24 24 24 n 04 96 0 0 0 A 05 0 96 0 0 C 06 9 67 9 11 C |
| Binding TFs: | 5e3l_B (Bacterial regulatory protein, Fis family) |
| Binding Sites: | 5e3l_C 5e3l_D |
| Publications: | Hancock SP, Stella S, Cascio D, Johnson RC. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. PLoS One : (2016). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.
